ABRC
donor stock number: hsp90.2KO rar1
NASC stock number: N68766
other name: hsp90.2-5KO rar1-21
Resource Type: seed
Availability: available
Donors:- Jeff Dangl
Donation Date: 06/25/2014
Date Released: 09/15/2015
Description:
hsp90.2KO rar1-21 double mutant generated by crossing single mutants hsp90.2KO (CS68765) and rar1-21 (CS68751). Homozygous hsp90.2KO mutant plants were selected with three PCR primers: Primer LP: CAAGGAAGGTCTGAAACTGGATGAG; Primer RP: CTACTAATACCCTGACAAAATTC; SALKLB: CCACCATCAAACAGGATTTTCGCCTGCTGGGGC. LP and RP are flanking primers, amplify in absence of insertion. RP and SALKLB are insertion specific primers, amplify in presence of insertion; Homozygous rar1 mutant plants were selected with the dCAP marker (5 -TCACGACGGAATGAAAGAGTGGAGCTGCTACTAG-3 ; 3 -TTTTGGAACCGATTTGGCCAGAACTGGTTTCTCAG-5 ; digested with SpeI)
Growth Requirement: none
Marker:
Background: Col (Columbia)
ABRC Comment:
Format Shipped: 100 seeds per vial
Base / Commercial Price: $15 / $120
Germplasm
Ploidy: 2
Susceptible to Pseudomonas syringae pv tomato (Pst) DC3000(avrRpm1).
Taxon: Arabidopsis thaliana 3702
Publications
| DOI | PubMed |
|---|---|
| 10.1093/emboj/cdg547 | 14592967 |
| 10.1073/pnas.0904877106 | 19487680 |
Transgenes
| Transgene | Description | Promoter | Reporter | Marker |
|---|---|---|---|---|
| pSGCOR1 | ||||
| pA11b |
Quality Control Comments
There is no quality control data for this stock.