SIGnAL's iSect tool can be used to design primers for verification of T-DNA insertions. If the link to the ISECT tool is not working, an alternative link can be found here.
The SIGnAL T-DNA FAQ also provides answers to common questions regarding the sequence indexed T-DNA insertion lines, including genotyping questions.
A selection of questions and answers specific to genotyping are shown below:
Q: Which T-DNA border flanking sequences were amplified and sequenced? What primers do you use for left border PCR?
A: The T-DNA left border sequence was used for PCR amplification of plant flanking sequences.
For PCR 1, we use LBa1 primer: 5' tggttcacgtagtgggccatcg 3'
For PCR 2 and sequencing, we use LBb1 primer: 5' gcgtggaccgcttgctgcaact 3'
See also:
LBb1.3 (Newly used by Salk Genotyping Project and with better results) ATTTTGCCGATTTCGGAAC
LB1 for SAIL lines C/418-451 of pCSA110-pDAP101_T-DNAs GCCTTTTCAGAAATGGATAAATAGCCTTGCTTCC
LB2 for SAIL lines C/390-423 of pCSA110-pDAP101_T-DNAs GCTTCCTATTATATCTTCCCAAATTACCAATACA
LB3 for SAIL lines C/350-383 of pCSA110-pDAP101_T-DNAs TAGCATCTGAATTTCATAACCAATCTCGATACAC
Q: What is the T-DNA transformation vector used to generate the SALK mutants?
A: pROK2. This vector is a derivative of pBIN19. See the SALK web site for a restriction map of the pROK2 vector and the sequence of pBIN19.
Q: I have used the SALK iSect tool to find suitable RP and when I take my whole gene sequence, I cannot find the region where the primer designed by the software aligns, but when I paste the result of the primer design in the T-express search it gives me the right gene.
A: The primer design in the web is based on insertion location and the genomic sequence. Therefore, LP or RP is not necessarily within the gene sequence, they can be in the gene's promoter or intergenic region.
Q: I am trying to design primers for a SAIL line. In regards to the insert primer, you provide 3 primer sequences (LB1-3). How do I determine which one to use for my line? There is no info on which "C/" group a particular line belongs to. If these were the primers used for Syngenta's TAIL PCR, should we use LB3 for any SAIL line?
A: The SAIL lines use TWO T-DNAs, however, they both have the same left border region sequences, even though the right borders are different. Therefore, any of LB1, LB2 or LB3 can be used for ALL SAIL lines. Nevertheless, Syngenta used the LB3 to sequence all their lines to get their FSTs. The c/ group has no difference with w/ group with respect to their LB primers, as well as its LP or RP. The iSect Primer tool is already adjusted to recognize the insertion direction, thus LB + RP will be always the combination for the insertion PCR, while LP+RP for the Wild Type.
Q: I am using the primers suggested in the web page and I got two bands for the homozygous mutant instead of one when I using the three primers together. There is always a strange band with a size nearly 800 bp in the mutant sample. I wonder if the primer suggested here has some problems (for the LBb1 I am using) or it is just normal to get three bands with different sizes in the reaction.
A: There is another primer LBb1.3 that is suggested as a better primer than LBb1. LBb1 can sometimes produce an extra band around 800bp and the LBb1.3 primer does not. In addition to switching to LBb1.3, I would suggest that you don't combine all three primers in a single reaction. This saves an extra reaction but can also result in artifact bands. Instead, you might want to run a Left Primer-Right Primer pair, and a Right Primer-LBb1.3 pair as two separate reactions on the DNA sample that you are genotyping.