Quality Control Details:

CS65889

researcher reported: The gct-2 allele can be identified using a dCAPS maker. Amplification with the dCAPS primer pair gct-2 F- actggagatggcttgtaagcatccg and gct-2 R ? tcgaagaaattcccaatgcg produces a 200bp product. The wt Col allele is cut at bp 175 by HpaII; the gct-2 allele does not cut. The amplification conditions need to be optimized- since these are dCAPS primers, in heterozygous plants, the mutant allele amplifies better than the wt allele. Try annealing at 50C, with 3mM MgCl2.

PCR

ABRC

07/22/2013