Resource Type: plasmid
Availability: available
Donors:- Julian Schroeder
- Felix Hauser
Donation Date: 02/12/2014
Date Released: 06/18/2014
Description:
p35S RWP-RK Y1 amiRNA; AmiRNA PCR product from TPK library cloned into pENTR D TOPO. Using LR clonase, amiRNA was transferred into vector pPHANTOM. pSoup (stock number CD3-1124) is required as a helper plasmid for efficient transformation of plants with this clone; amiRNA sequence: TACATTAGGAGTCCACTCAGG; predicted targeted loci: AT1G20640;AT1G64530;AT1G76350;AT2G17150;AT4G24020
Growth Requirement: grow in LB media at 37 C overnight
Marker: spectinomycin
Background:
ABRC Comment: This material contains Gateway(TM) Technology owned by ThermoFisher Scientific (formerly known as Life Technologies/ Invitrogen Corporation). Distributed under Gateway Open Architecture Policy.
Format Shipped: bacterial stab
Base / Commercial Price: $15 / $120
Plasmid
Promoter:
Reporter:
Type: RNAi clone
E. coli Mach1
Arabidopsis thaliana 3702
Additional Information
Quality Control Comments
There is no quality control data for this stock.
Note
Gateway(TM)_Open_ArchitectureWhen it was initially launched in 1999, there were several use restrictions around Gateway Technology that required additional licensing. These limitations included research use by industrial entities, distribution of research materials by academic investigators, and any commercial use. In 2003, we instituted the Gateway Open Architecture in response to the urgent need of the research communities for open access to Gateway Technology for scientific research. The majority of genome-wide initiatives are funded by government agencies which require all resources and information, including data, software, and biological materials to be openly accessible. We realized that our policies were too restrictive, and instead of enabling your research with advanced technology, we were impeding it with our interest in protecting intellectual property. Our vision, including strategic business pursuits such as corporate licensing, must align with our customers needs. We believe we share a common quest with you to support and facilitate cutting-edge life science research; thus we have introduced a new open architecture for Gateway Technology. Under this new licensing policy:
Academic and government researchers may create and freely distribute Gateway entry clones (containing attL1 and attL2 sites) and expression clones (containing attB1 and attB2 sites) for research use without licensing fees or royalties.
Any organization may now freely distribute Gateway entry clones created by Academic or Government researchers, for research use, without paying licensing fees or royalties, and may distribute Gateway expression clones created by Academic or Government researchers, for research use, for a nominal fee of up to US $10 per clone.
The rights to perform the Gateway recombinational cloning reaction, for research purposes, with these distributed clones is conveyed by the purchase of InvitrogenTM Gateway ClonaseTM enzyme.
We will not assert a claim against the buyer of infringement based upon the manufacture, use or sale of a therapeutic, clinical diagnostic, vaccine or prophylactic product developed in research by the buyer provided that no method claim in the corresponding patents were used in the manufacture of such product.
We believe that this policy of open access to Gateway clones for scientific research purposes is the best way for us to support your efforts in the advancement of global life sciences. We are committed to ensuring that new information and resources will be accessible to the broader community by first, eliminating unwarranted licensing restrictions and by second, providing the resources necessary as a key distributor and partner.