Name / Stock Number: CS67226

View Order History

NASC stock number: N67226

donor stock number: P2B9-2-7

Resource Type: seed

Availability: available

Donors:
  • Jose Alonso
  • Anna Stepanova
  • Jeonga Yun

Donation Date: 02/17/2012

Date Released: 03/12/2012

Description:

This whole-gene translation fusion was generated by recombineering (Zhou et al. (2011) Plant J. 66:712-723). The Ypet yellow fluorescent protein DNA just after the following sequence: (i.e. just before the stop codon): GTGGGAGAGGCGACAAGGATGTTCAGACTGCAATCAAGTATCTCGAAGTT of the gene At4g27070 in the JAtY clone JAtY69B09. Transgenic plants are homozygous, but can be selected in BASTA.

Growth Requirement: none

Marker:

Background: Col (Columbia)

ABRC Comment:

Format Shipped: 100 seeds per vial

Base / Commercial Price: $15 / $120

Genes

Gene Names Evidence
AT4G27070
  • TSB2
  • tryptophan synthase beta-subunit 2
    		•  transgene SIGnAL TAIR ARAPORT

    Germplasm

    2

    Arabidopsis thaliana 3702

    Additional Information

    DOI PubMed
    10.1111/j.1365-313X.2011.04524.x 21294796
    Transgene Description Promoter Reporter Marker
    Alonso-P2B9 At4g27070 whole-gene translation fusion, Ypet yellow fluorescent protein DNA sequence inserted just after the following sequence (i.e. just before the stop codon of the gene): GTGGGAGAGGCGACAAGGATGTTCAGACTGCAATCAAGTATCTCGAAGTT in the clone JAtY69B09 YFP BASTA

    Quality Control Comments

    Add your quality control comment here

    There is no quality control data for this stock.