Name / Stock Number: CS68167

NASC stock number: N68167

other name: p35S:amiRNA-c2c2-dof-G1

other name: p35S c2c2_dof G1 amiRNA

donor stock number: 43-3T2

Resource Type: seed

Availability: available

Donors:
  • Felix Hauser
  • Julian Schroeder

Donation Date: 10/23/2013

Date Released: 06/02/2014

Description:

AmiRNA line. Original donation was T2 generation of the TPK amiRNA library. AmiRNA sequence and primers were designed using the WMD Design Tool online. AmiRNA PCR product was cloned into pENTR D TOPO, then transferred to vector pRS1102 using the LR clonase method. pSOUP (stock number CD3-1124) used as a helper plasmid for transformation. Using the floral dip method, pRAB18:GFP plants (CS68523) were transformed. Heterozygous. Basta resistant. Predicted targeted loci: AT1G07640; AT1G28310; AT1G29160; AT1G37340; AT1G47655; AT1G51700; AT1G64620; AT2G28510; AT2G28810; AT2G46590; AT3G21270; AT3G45610; AT3G50410; AT3G52440; AT3G55370; AT3G61850; AT4G24060; AT5G60200; AT5G60850; AT5G62430; AT5G62940; AT5G65590; AT5G66940; amiRNA sequence: TAGTAACAGAACTTAGTGTTG; Listed targeted loci are predictions, and are not experimentally verified.

Growth Requirement: Basta resistant

Marker: BASTA

Background: Col (Columbia)

ABRC Comment:

Format Shipped: 100 seeds per vial

Base / Commercial Price: $15 / $120

Germplasm

Ploidy: 2

Taxon: Arabidopsis thaliana 3702

Publications

DOI PubMed
10.1105/tpc.113.112805 23956262

Transgenes

Transgene Description Promoter Reporter Marker
pRAB18:GFP RAB18 GFP kanamycin
pFH0043 RNAi construct BASTA

Quality Control Comments

There is no quality control data for this stock.