NASC stock number: N68167
other name: p35S:amiRNA-c2c2-dof-G1
other name: p35S c2c2_dof G1 amiRNA
donor stock number: 43-3T2
Resource Type: seed
Availability: available
Donors:- Felix Hauser
- Julian Schroeder
Donation Date: 10/23/2013
Date Released: 06/02/2014
Description:
AmiRNA line. Original donation was T2 generation of the TPK amiRNA library. AmiRNA sequence and primers were designed using the WMD Design Tool online. AmiRNA PCR product was cloned into pENTR D TOPO, then transferred to vector pRS1102 using the LR clonase method. pSOUP (stock number CD3-1124) used as a helper plasmid for transformation. Using the floral dip method, pRAB18:GFP plants (CS68523) were transformed. Heterozygous. Basta resistant. Predicted targeted loci: AT1G07640; AT1G28310; AT1G29160; AT1G37340; AT1G47655; AT1G51700; AT1G64620; AT2G28510; AT2G28810; AT2G46590; AT3G21270; AT3G45610; AT3G50410; AT3G52440; AT3G55370; AT3G61850; AT4G24060; AT5G60200; AT5G60850; AT5G62430; AT5G62940; AT5G65590; AT5G66940; amiRNA sequence: TAGTAACAGAACTTAGTGTTG; Listed targeted loci are predictions, and are not experimentally verified.
Growth Requirement: Basta resistant
Marker: BASTA
Background: Col (Columbia)
ABRC Comment:
Format Shipped: 100 seeds per vial
Base / Commercial Price: $15 / $120
Germplasm
Ploidy: 2
Taxon: Arabidopsis thaliana 3702
Publications
| DOI | PubMed |
|---|---|
| 10.1105/tpc.113.112805 | 23956262 |
Transgenes
| Transgene | Description | Promoter | Reporter | Marker |
|---|---|---|---|---|
| pRAB18:GFP | RAB18 | GFP | kanamycin | |
| pFH0043 | RNAi construct | BASTA |
Quality Control Comments
There is no quality control data for this stock.