NASC stock number: N68213
other name: p35S SBP_R1_amiRNA
donor stock number: 72-3T2
Resource Type: seed
Availability: available
Donors:- Felix Hauser
- Julian Schroeder
Donation Date: 10/23/2013
Date Released: 06/02/2014
Description:
AmiRNA line. Original donation was T2 generation of the TPK amiRNA library. AmiRNA sequence and primers were designed using the WMD Design Tool online. AmiRNA PCR product was cloned into pENTR D TOPO, then transferred to vector pRS1102 using the LR clonase method. pSOUP (stock number CD3-1124) used as a helper plasmid for transformation. Using the floral dip method, pRAB18:GFP plants (CS68523) were transformed. Heterozygous. Basta resistant. Predicted targeted loci: AT1G27360; AT1G27370; AT1G53160; AT1G69170; AT2G33810; AT2G42200; AT3G57920; AT5G43270; AT5G50570; AT5G50670; amiRNA sequence: TGACAGAAGAGAGAGAGCACC; Listed targeted loci are predictions, and are not experimentally verified.
Growth Requirement: Basta resistant
Marker: BASTA
Background: Col (Columbia)
ABRC Comment:
Format Shipped: 100 seeds per vial
Base / Commercial Price: $15 / $120
Germplasm
2
Similar phenotype to miRNA 156b overexpression lines. Moderate delay in flowering under long days, initiate rosette leaves faster than wild-type under short days, severe decrease of apical dominance, and increased leaf number ((PMID: 15809034).
Arabidopsis thaliana 3702
Additional Information
DOI | PubMed |
---|---|
10.1105/tpc.113.112805 | 23956262 |
Transgene | Description | Promoter | Reporter | Marker |
---|---|---|---|---|
pRAB18:GFP | RAB18 | GFP | kanamycin | |
pFH0072 | RNAi construct | BASTA |
Quality Control Comments
There is no quality control data for this stock.