NASC stock number: N68736
donor stock number: atmc1 atmc2
Resource Type: seed
Availability: available
Donors:- Jeff Dangl
Donation Date: 06/25/2014
Date Released: 09/03/2014
Description:
Double mutant generated by crossing atmc1 (CS68732) and atmc2 (CS68733). Homozygous atmc1 mutant plants were selected with three PCR primers: Primer LP: GCGTCACCTTCTCATCAACA; Primer RP: ACGGTACCACTATGGCAAGC; GABI LB. LP and RP are flanking primers, amplify in absence of insertion. RP and GABI LB are insertion specific primers, amplify in presence of insertion. Homozygous atmc2 mutant plants were selected with three PCR primers: Primer LP: CCTTTCCCCAACTCATCTCC; Primer RP: GGCCGTACGATTGTAGCATT; SALKLB: CCACCATCAAACAGGATTTTCGCCTGCTGGGGC. LP and RP are flanking primers, amplify in absence of insertion. RP and SALKLB are insertion specific primers, amplify in presence of insertion.
Growth Requirement: none
Marker:
Background: Col (Columbia)
ABRC Comment:
Format Shipped: 100 seeds per vial
Base / Commercial Price: $15 / $120
Germplasm
Ploidy: 2
Taxon: Arabidopsis thaliana 3702
Publications
| DOI | PubMed |
|---|---|
| 10.1126/science.1194980 | 21097903 |
Transgenes
| Transgene | Description | Promoter | Reporter | Marker |
|---|---|---|---|---|
| pAC161 | T-DNA | sulfadiazine | ||
| pROK2 | T-DNA | kanamycin |
Quality Control Comments
There is no quality control data for this stock.