Name / Stock Number: CS68736

NASC stock number: N68736

donor stock number: atmc1 atmc2

Resource Type: seed

Availability: available

Donors:
  • Jeff Dangl

Donation Date: 06/25/2014

Date Released: 09/03/2014

Description:

Double mutant generated by crossing atmc1 (CS68732) and atmc2 (CS68733). Homozygous atmc1 mutant plants were selected with three PCR primers: Primer LP: GCGTCACCTTCTCATCAACA; Primer RP: ACGGTACCACTATGGCAAGC; GABI LB. LP and RP are flanking primers, amplify in absence of insertion. RP and GABI LB are insertion specific primers, amplify in presence of insertion. Homozygous atmc2 mutant plants were selected with three PCR primers: Primer LP: CCTTTCCCCAACTCATCTCC; Primer RP: GGCCGTACGATTGTAGCATT; SALKLB: CCACCATCAAACAGGATTTTCGCCTGCTGGGGC. LP and RP are flanking primers, amplify in absence of insertion. RP and SALKLB are insertion specific primers, amplify in presence of insertion.

Growth Requirement: none

Marker:

Background: Col (Columbia)

ABRC Comment:

Format Shipped: 100 seeds per vial

Base / Commercial Price: $15 / $120

Germplasm

2

Arabidopsis thaliana 3702

Additional Information

DOI PubMed
10.1126/science.1194980 21097903
Transgene Description Promoter Reporter Marker
pAC161 T-DNA sulfadiazine
pROK2 T-DNA kanamycin

Quality Control Comments

There is no quality control data for this stock.