ABRC
NASC stock number: N68738
other name: lsd1KO
donor stock number: lsd1-2
Resource Type: seed
Availability: available
Donors:- Jeff Dangl
Donation Date: 06/25/2014
Date Released: 09/03/2014
Description:
lsd1-2 mutant; Identified by PCR genotyping from SALK line (SALK_042687). Homozygous lsd1-2 mutant plants were selected with three PCR primers: Primer F: CTCCAATCAGGTTGCCCATGCT; Primer R: CACCAACTTTCCGCTTTCATCA; SALKLB-a1: ATGGTTCACGTAGTGGGCCATC. Primer F and R are flanking primers, amplify in absence of insertion. F and SALKLB-a1 are insertion specific primers, amplify in presence of insertion.
Growth Requirement: none
Marker:
Background: Col (Columbia)
ABRC Comment:
Format Shipped: 100 seeds per vial
Base / Commercial Price: $15 / $120
Germplasm
Ploidy: 2
Strong salicylic acid-induced cell death.
Taxon: Arabidopsis thaliana 3702
Publications
| DOI | PubMed |
|---|---|
| 10.1038/sj.emboj.7601312 | 16957775 |
Transgenes
| Transgene | Description | Promoter | Reporter | Marker |
|---|---|---|---|---|
| pROK2 | T-DNA | kanamycin |
Quality Control Comments
There is no quality control data for this stock.