Name / Stock Number: CS68765

NASC stock number: N68765

other name: hsp90.2-5

donor stock number: hsp90.2KO

Resource Type: seed

Availability: not distributed, currently distributed as CS68729

Donors:
  • Jeff Dangl

Donation Date: 06/25/2014

Date Released: 09/03/2014

Description:

hsp90.2-5KO mutant; Identified by PCR genotyping from SALK line (SALK_058553). Homozygous hsp90.2KO mutant plants were selected with three PCR primers: Primer LP: CAAGGAAGGTCTGAAACTGGATGAG; Primer RP: CTACTAATACCCTGACAAAATTC; SALKLB: CCACCATCAAACAGGATTTTCGCCTGCTGGGGC. LP and RP are flanking primers, amplify in absence of insertion. RP and SALKLB are insertion specific primers, amplify in presence of insertion.

Growth Requirement: none

Marker:

Background: Col (Columbia)

ABRC Comment:

Format Shipped: 100 seeds per vial

Base / Commercial Price: $15 / $120

Germplasm

Ploidy: 2

Increased occurrence of developmental defects including narrowly-shaped deformed true leaves and delayed development. Pleiotropic developmental changes are very modest.

Taxon: Arabidopsis thaliana 3702

Publications

DOI PubMed
10.1093/emboj/cdg547 14592967

Transgenes

Transgene Description Promoter Reporter Marker
pROK2 T-DNA kanamycin

Quality Control Comments

There is no quality control data for this stock.