ABRC
NASC stock number: N68753
donor stock number: rar1 sgt1a
other name: rar1-21 sgt1aKO
Resource Type: seed
Availability: available
Donors:- Jeff Dangl
Donation Date: 06/25/2014
Date Released: 09/15/2015
Description:
rar1-21 sgt1aKO double mutant generated by crossing single mutants rar1-21 (CS68751) and sgt1aKO (CS68750). Homozygous sgt1aKO mutant plants were selected with three PCR primers: Primer LP: CTTGAAAAGGGTGCCTCTATCACGC; Primer RP: CATCAGATGACACTGAAGAAGGAAAAGG; SALKLB: CCACCATCAAACAGGATTTTCGCCTGCTGGGGC. LP and RP are flanking primers, amplify in absence of insertion. RP and SALKLB are insertion specific primers, amplify in presence of insertion. Homozygous rar1-21 mutant plants were selected with the dCAP marker (5 -TCACGACGGAATGAAAGAGTGGAGCTGCTACTAG-3 ; 3 -TTTTGGAACCGATTTGGCCAGAACTGGTTTCTCAG-5 ; digested with SpeI)
Growth Requirement: none
Marker:
Background: Col (Columbia)
ABRC Comment:
Format Shipped: 100 seeds per vial
Base / Commercial Price: $15 / $120
Germplasm
Ploidy: 2
Susceptible to Pseudomonas syringae pv tomato (Pst) DC3000(avrRpm1). Severe reduction of DC3000(avrRpm1)-induced hypersensitive response.
Taxon: Arabidopsis thaliana 3702
Publications
| DOI | PubMed |
|---|---|
| 10.1126/science.1109977 | 15976272 |
Transgenes
| Transgene | Description | Promoter | Reporter | Marker |
|---|---|---|---|---|
| pROK2 | T-DNA | kanamycin | ||
| pSGCOR1 | ||||
| pA11b |
Quality Control Comments
There is no quality control data for this stock.