donor stock number: hsp90.2-3 hsp90.1KO
NASC stock number: N68769
Resource Type: seed
Availability: available
Donors:- Jeff Dangl
Donation Date: 06/25/2014
Date Released: 09/15/2015
Description:
hsp90.2-3 and hsp90.1KO double mutant generated by crossing single mutants hsp90.2-3 and hsp90.1KO (CS68767 - isolated from SALK_075596). Homozygous hsp90.2-3 mutant plants were selected with the dCAP marker (5 - CTTCGATTTTTTCCGATCTACGACAATGGC-3 ; 3 - CAAGGTTGTTGACCAAATCTAATAGAAGAAGCACG-5 ; digested with AseI) ; Homozygous hsp90.1KO mutant plants were selected with three PCR primers: Primer LP: GAATACTTGGAGGAGAGGAG; Primer RP: CCCTAGAAGTAGTCACAATGTTCAA; SALKLB: CCACCATCAAACAGGATTTTCGCCTGCTGGGGC. LP and RP are flanking primers, amplify in absence of insertion. RP and SALKLB are insertion specific primers, amplify in presence of insertion.
Growth Requirement: none
Marker:
Background: Col (Columbia)
ABRC Comment:
Format Shipped: 100 seeds per vial
Base / Commercial Price: $15 / $120
Germplasm
Ploidy: 2
Taxon: Arabidopsis thaliana 3702
Publications
| DOI | PubMed |
|---|---|
| 10.1073/pnas.0904877106 | 19487680 |
Transgenes
| Transgene | Description | Promoter | Reporter | Marker |
|---|---|---|---|---|
| pROK2 | T-DNA | kanamycin |
Quality Control Comments
There is no quality control data for this stock.