Name / Stock Number: CS68770

donor stock number: hsp90.1KO hsp90.2-7

NASC stock number: N68770

other name: hsp90.2-7 hsp90.1KO

Resource Type: seed

Availability: available

Donors:
  • Jeff Dangl

Donation Date: 06/25/2014

Date Released: 09/15/2015

Description:

hsp90.1KO hsp90.2-7 double mutant generated by crossing single mutants hsp90.1KO (CS68767 - isolated from SALK_075596) and hsp90.2-7. Homozygous hsp90.2-7 mutant plants were selected with the dCAP marker (5 - GATGATGAGGGAAAGCAACTGGTTGATCTAAG-3 ; 3 - GGGCCTTAAAATGGCCCCCATCA-5 ; digested with HindIII) ; Homozygous hsp90.1KO mutant plants were selected with three PCR primers: Primer LP: GAATACTTGGAGGAGAGGAG; Primer RP: CCCTAGAAGTAGTCACAATGTTCAA; SALKLB: CCACCATCAAACAGGATTTTCGCCTGCTGGGGC. LP and RP are flanking primers, amplify in absence of insertion. RP and SALKLB are insertion specific primers, amplify in presence of insertion.

Growth Requirement: none

Marker:

Background: Col (Columbia)

ABRC Comment:

Format Shipped: 100 seeds per vial

Base / Commercial Price: $15 / $120

Germplasm

Ploidy: 2

Taxon: Arabidopsis thaliana 3702

Publications

DOI PubMed
10.1073/pnas.0904877106 19487680

Transgenes

Transgene Description Promoter Reporter Marker
pROK2 T-DNA kanamycin

Quality Control Comments

There is no quality control data for this stock.