ABRC
donor stock number: hsp90.2KO RPM1-myc
NASC stock number: N68780
other name: hsp90.2-5KO RPM1-myc
Resource Type: seed
Availability: available
Donors:- Jeff Dangl
Donation Date: 06/25/2014
Date Released: 09/15/2015
Description:
hsp90.2-5KO mutant containing pRPM1::RPM1::myc transgene. Plants containing pRPM1::RPM1::myc constructor were selected with primers: 5 - caatgcatacatgggacctaggttg -3 and 3 - cgtaattcaacagaaattatatgataatcatcgcaa -5 .Homozygous hsp90.2-5KO mutant plants were selected with three PCR primers: Primer 1: CAAGGAAGGTCTGAAACTGGATGAG; Primer 2: CTACTAATACCCTGACAAAATTC; SALKLB: CCACCATCAAACAGGATTTTCGCCTGCTGGGGC. Primer 1 and 2 are flanking primers, amplify in absence of insertion. Primer 2 and SALKLB are insertion specific primers, amplify in presence of insertion.
Growth Requirement: none
Marker:
Background: Col (Columbia)
ABRC Comment:
Format Shipped: 100 seeds per vial
Base / Commercial Price: $15 / $120
Germplasm
Ploidy: 2
Taxon: Arabidopsis thaliana 3702
Transgenes
| Transgene | Description | Promoter | Reporter | Marker |
|---|---|---|---|---|
| pROK2 | T-DNA | kanamycin | ||
| pRPM1::RPM1::myc |
Quality Control Comments
There is no quality control data for this stock.