donor stock number: rin4 rps2 rpm1
NASC stock number: N68760
other name: rin4KO rps2-101c rpm1-3
Resource Type: seed
Availability: not available
Donors:- Jeff Dangl
Donation Date: 06/25/2014
Date Released: 06/02/2016
Description:
Triple mutant rin4 rpm1 rps2 was constructed like the rin4 rps2 double mutant described by PMID: 12581527. Homozygous rin4KO mutant plants were selected with three PCR primers: Primer LP: ATATGAGAAGCCGAGAAGAGAGCGAGTTGA; Primer RP: GGTACCCAAATATCTCTGATTCATATCAAATCAGTTAC; SALKLB: CCACCATCAAACAGGATTTTCGCCTGCTGGGGC. LP and RP are flanking primers, amplify in absence of insertion. RP and SALKLB are insertion specific primers, amplify in presence of insertion. Homozygous rpm1-3 (CS68739, formerly called rps3-3) mutant plants were selected with the dCAP marker (5 -AATTAACCCTCACTAAAGAGAACATGGAAGAGACTTGT-3 ; 3 -ACTGCTGTGAAGTGAGCTGTTT-5 ; digested with AvrII); Homozygous rps2-101c mutant plants were selected with the dCAP marker (5 -TGTTTATGGACCTGGTGGGGT -3 ; 3 - ACAGCTCCCACGCGTGTTTCT -5 ; digested with DdeI)
Growth Requirement: none
Marker:
Background: Col (Columbia)
ABRC Comment:
Format Shipped: 100 seeds per vial
Base / Commercial Price: $15 / $120
Germplasm
2
Susceptible to pathogen Pto DC3000 carrying virulence effector gene avrRpm1or avrRpt2.
Arabidopsis thaliana 3702
Additional Information
| DOI | PubMed |
|---|---|
| 10.1105/tpc.104.024117 | 15361584 |
| Transgene | Description | Promoter | Reporter | Marker |
|---|---|---|---|---|
| pROK2 | T-DNA | kanamycin |
Quality Control Comments
There is no quality control data for this stock.