Name / Stock Number: CS68783

donor stock number: RPM1-myc rpm1 rin4 rps2

NASC stock number: N68783

other name: RPM1-myc rpm1-3 rin4KO rps2-101c

Resource Type: seed

Availability: available

Donors:
  • Jeff Dangl

Donation Date: 06/25/2014

Date Released: 06/02/2016

Description:

rin4KO rps2-101c rpm1 triple mutant containing pRPM1::RPM1::myc transgene; Plants containing pRPM1::RPM1::myc constructor were selected with primers: 5 - caatgcatacatgggacctaggttg -3 and 3 - cgtaattcaacagaaattatatgataatcatcgcaa -5 . Homozygous rin4KO mutant plants were selected with three PCR primers: Primer LP: ATATGAGAAGCCGAGAAGAGAGCGAGTTGA; Primer RP: GGTACCCAAATATCTCTGATTCATATCAAATCAGTTAC; SALKLB: CCACCATCAAACAGGATTTTCGCCTGCTGGGGC. LP and RP are flanking primers, amplify in absence of insertion. RP and SALKLB are insertion specific primers, amplify in presence of insertion.; Homozygous rps2-101c mutant plants were selected with the dCAP marker (5 -TGTTTATGGACCTGGTGGGGT -3 ; 3 - ACAGCTCCCACGCGTGTTTCT -5 ; digested with DdeI)

Growth Requirement: none

Marker:

Background: Col (Columbia)

ABRC Comment:

Format Shipped: 100 seeds per vial

Base / Commercial Price: $15 / $120

Germplasm

2

Arabidopsis thaliana 3702

Additional Information

Transgene Description Promoter Reporter Marker
pROK2 T-DNA kanamycin
pRPM1::RPM1::myc

Quality Control Comments

There is no quality control data for this stock.