donor stock number: RPM1-myc rpm1 rin4 rps2
NASC stock number: N68783
other name: RPM1-myc rpm1-3 rin4KO rps2-101c
Resource Type: seed
Availability: available
Donors:- Jeff Dangl
Donation Date: 06/25/2014
Date Released: 06/02/2016
Description:
rin4KO rps2-101c rpm1 triple mutant containing pRPM1::RPM1::myc transgene; Plants containing pRPM1::RPM1::myc constructor were selected with primers: 5 - caatgcatacatgggacctaggttg -3 and 3 - cgtaattcaacagaaattatatgataatcatcgcaa -5 . Homozygous rin4KO mutant plants were selected with three PCR primers: Primer LP: ATATGAGAAGCCGAGAAGAGAGCGAGTTGA; Primer RP: GGTACCCAAATATCTCTGATTCATATCAAATCAGTTAC; SALKLB: CCACCATCAAACAGGATTTTCGCCTGCTGGGGC. LP and RP are flanking primers, amplify in absence of insertion. RP and SALKLB are insertion specific primers, amplify in presence of insertion.; Homozygous rps2-101c mutant plants were selected with the dCAP marker (5 -TGTTTATGGACCTGGTGGGGT -3 ; 3 - ACAGCTCCCACGCGTGTTTCT -5 ; digested with DdeI)
Growth Requirement: none
Marker:
Background: Col (Columbia)
ABRC Comment:
Format Shipped: 100 seeds per vial
Base / Commercial Price: $15 / $120
Germplasm
2
Arabidopsis thaliana 3702
Additional Information
| Transgene | Description | Promoter | Reporter | Marker |
|---|---|---|---|---|
| pROK2 | T-DNA | kanamycin | ||
| pRPM1::RPM1::myc |
Quality Control Comments
There is no quality control data for this stock.