Name / Stock Number: CS69565

donor stock number: F1-51-5

NASC stock number: N69565

Resource Type: seed

Availability: available

Donors:
  • Jeonga Yun
  • Anna Stepanova
  • Jose Alonso

Donation Date: 08/08/2016

Date Released: 10/27/2016

Description:

Transgenic line; This whole-gene translation fusion was generated by recombineering (Zhou et al. (2011) Plant J. 66:712-723). The 3xYpet yellow fluorescent protein DNA just after the following sequence: (i.e. just before the stop codon): TGCCCCTCACAAAGGAAGTCCAAATTGAGTACTTGCTTAGAAGACTGGAT of the gene At1g69370 in the JAtY clone JAtY73A11. Homozygous for the transgene. Basta resistant.

Growth Requirement: none

Marker: BASTA

Background: Col (Columbia)

ABRC Comment:

Format Shipped: 100 seeds per vial

Base / Commercial Price: $15 / $120

Germplasm

2

Arabidopsis thaliana 3702

Additional Information

DOI PubMed
10.1111/j.1365-313X.2011.04524.x 21294796
Transgene Description Promoter Reporter Marker
Alonso-P2D10 At1g69370 whole-gene translation fusion, 3xYpet yellow fluorescent protein DNA sequence was inserted just after the following sequence (i.e. just before the stop codon of the gene): TGCCCCTCACAAAGGAAGTCCAAATTGAGTACTTGCTTAGAAGACTGGAT in the clone JAtY73A11. YFP BASTA

Quality Control Comments

There is no quality control data for this stock.