donor stock number: B2-11-2
NASC stock number: N69573
Resource Type: seed
Availability: available
Donors:- Jeonga Yun
- Anna Stepanova
- Jose Alonso
Donation Date: 08/08/2016
Date Released: 10/27/2016
Description:
Transgenic line; This whole-gene translation fusion was generated by recombineering (Zhou et al. (2011) Plant J. 66:712-723). The 3xYpet yellow fluorescent protein DNA just after the following sequence: (i.e. just before the stop codon): GTTACCCCATGGATATGACACCATGGTCCATGACATCCACAGAAGAAGCA of the gene At3g44720 in the JAtY clone JAtY67M21. Homozygous for the transgene. Basta resistant.
Growth Requirement: none
Marker: BASTA
Background: Col (Columbia)
ABRC Comment:
Format Shipped: 100 seeds per vial
Base / Commercial Price: $15 / $120
Germplasm
2
Arabidopsis thaliana 3702
Additional Information
| Transgene | Description | Promoter | Reporter | Marker |
|---|---|---|---|---|
| Alonso-P2E8 | At3g44720 whole-gene translation fusion, 3xYpet yellow fluorescent protein DNA sequence was inserted just after the following sequence (i.e. just before the stop codon of the gene): GTTACCCCATGGATATGACACCATGGTCCATGACATCCACAGAAGAAGCA in the clone JAtY67M21 | YFP | BASTA |
Quality Control Comments
There is no quality control data for this stock.