donor stock number: C6-8-3
NASC stock number: N69581
Resource Type: seed
Availability: available
Donors:- Jeonga Yun
- Anna Stepanova
- Jose Alonso
Donation Date: 08/08/2016
Date Released: 10/27/2016
Description:
Transgenic line; This whole-gene translation fusion was generated by recombineering (Zhou et al. (2011) Plant J. 66:712-723). The 3xYpet yellow fluorescent protein DNA just after the following sequence: (i.e. just before the stop codon): GAGGAAGCTCTGATCGAAGCATTAACGAGTTTATAGAGAGTTTAGGGAAG of the gene At1g24100 in the JAtY clone JAtY72N13. Homozygous for the transgene. Basta resistant.
Growth Requirement: none
Marker: BASTA
Background: Col (Columbia)
ABRC Comment:
Format Shipped: 100 seeds per vial
Base / Commercial Price: $15 / $120
Germplasm
2
Arabidopsis thaliana 3702
Additional Information
Transgene | Description | Promoter | Reporter | Marker |
---|---|---|---|---|
Alonso-P2B10 | At1g24100 whole-gene translation fusion, 3xYpet yellow fluorescent protein DNA sequence inserted just after the following sequence (i.e. just before the stop codon of the gene): GAGGAAGCTCTGATCGAAGCATTAACGAGTTTATAGAGAGTTTAGGGAAG in the clone JAtY72N13 | YFP | BASTA |
Quality Control Comments
There is no quality control data for this stock.