NASC stock number: N2107349
donor stock number: pPHE::NTF; pPHE::BirA
other name: INT
Resource Type: seed
Availability: available
Donors:- Claudia Kohler
- Jordi Moreno-Romero
Donation Date: 01/17/2020
Date Released: 02/28/2020
Description:
Endosperm-specific promoter expressing NTF and BirA allowing nuclei purification with the INTACT method. NTF and BirA independent lines were generated by transformation using Agrobaterium with pPHE::NTF and pPHE::BirA constructs respectively. Transgenic lines were selected in vitro on ppt (basta). Selected lines with appropriate NTF and BirA levels were cross-pollinated and homozygous lines selected (using the GFP fluorescence signal of the NTF construct and specific PCR-primers for the BirA transgene). The pPHE::NTF; pPHE::BirA double transgenic line has been named as INT.
Growth Requirement: none
Marker:
Background: Col (Columbia)
ABRC Comment:
Format Shipped: 100 seeds per vial
Base / Commercial Price: $15 / $120
Germplasm
2
no visible phenotype
Arabidopsis thaliana 3702
Additional Information
| DOI | PubMed |
|---|---|
| 10.15252/embj.201593534 | 27113256 |
| Transgene | Description | Promoter | Reporter | Marker |
|---|---|---|---|---|
| pPHE::BirA | INTACT construct, 3 kb PHE1 endosperm specific promoter driving expression of a BIRA fragment generated using primers attB1 5 GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGAAGGATAACACCGTG 3 and attB2 5 GGGGACCACTTTGTACAAGAAAGCTGGGTACGACGGGGATCTGGATTT 3 | PHE1 | BASTA | |
| pPHE::NTF | INTACT construct, 3 kb PHE1 endosperm specific promoter driving expression of an NTF fragment generated using primers attB1 5 GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGAATCATTCAGCGAAA 3 and attB2 5 GGGGACCACTTTGTACAAGAAAGCTGGGTACATCTAGTAACATAGATG 3 | PHE1 | BASTA |
Quality Control Comments
There is no quality control data for this stock.