donor stock number: dde2; pPHE::NTF; pPHE::BirA
other name: dde2; INT
NASC stock number: N2107350
Resource Type: seed
Availability: not yet received
Donors:- Jordi Moreno-Romero
- Claudia Kohler
Donation Date:
Date Released: 04/06/2020
Description:
dde2 (aos1-1) mutant, isolated from SALK_017756, was crossed with the INT line (CS2107349) and triple homozygous (NTF transgene, BirA transgene and dde2 mutant) plants were selected. The INT transgenic line has an endosperm-specific promoter expressing NTF and BirA allowing nuclei purification with the INTACT method.
Growth Requirement: inflorescences have to be sprayed with MeJA for self-fertilization
Marker: BASTA, kanamycin
Background: Col (Columbia)
ABRC Comment:
Format Shipped: 100 seeds per vial
Base / Commercial Price: $15 / $120
Germplasm
2
The dde2 (aos1-1) mutant is defective in the anther dehiscence process and thus flowers are not self pollinated and seeds are not produced.
Arabidopsis thaliana 3702
Additional Information
| Transgene | Description | Promoter | Reporter | Marker |
|---|---|---|---|---|
| pPHE::BirA | INTACT construct, 3 kb PHE1 endosperm specific promoter driving expression of a BIRA fragment generated using primers attB1 5 GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGAAGGATAACACCGTG 3 and attB2 5 GGGGACCACTTTGTACAAGAAAGCTGGGTACGACGGGGATCTGGATTT 3 | PHE1 | BASTA | |
| pPHE::NTF | INTACT construct, 3 kb PHE1 endosperm specific promoter driving expression of an NTF fragment generated using primers attB1 5 GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGAATCATTCAGCGAAA 3 and attB2 5 GGGGACCACTTTGTACAAGAAAGCTGGGTACATCTAGTAACATAGATG 3 | PHE1 | BASTA | |
| pROK2 | T-DNA | kanamycin |
Quality Control Comments
There is no quality control data for this stock.