Name / Stock Number: CS67167

NASC stock number: N67167

donor stock number: P1E2-6

Resource Type: seed

Availability: available

Donors:
  • Jose Alonso
  • Anna Stepanova
  • Jeonga Yun

Donation Date: 02/17/2012

Date Released: 03/12/2012

Description:

This whole-gene translation fusion was generated by recombineering (Zhou et al. (2001) Plant J. 66:712-723). The Venus yellow fluorescent protein DNA sequence (obtained from Dr. Oliver Hobert at Columbia University Medical Center, New York. (ref. PLoS ONE 4(3): e4625. doi:10.1371/journal.pone.0004625) was inserted just after the following sequence: TGGGCAAAAAAGGTAGCGACGTGGAAGACGGCGGTCCCGGTCCTAGGAAA (internal fusion in the gene At2g21050/LAX2 in the JAtY clone JAtY66F09. Transgenic plants are hemizygous and can be selected in BASTA.

Growth Requirement: basta resistant

Marker:

Background: Col (Columbia)

ABRC Comment:

Format Shipped: 100 seeds per vial

Base / Commercial Price: $13 / $104

Germplasm

2

Arabidopsis thaliana 3702

Additional Information

Transgene Description Promoter Reporter Marker
Alonso-P1E2 LAX2 whole-gene translation fusion, Venus yellow fluorescent protein DNA sequence inserted just after the following sequence: TGGGCAAAAAAGGTAGCGACGTGGAAGACGGCGGTCCCGGTCCTAGGAAA in the clone JAtY66F09 Venus BASTA

Quality Control Comments

There is no quality control data for this stock.