Name / Stock Number: CS67170

NASC stock number: N67170

donor stock number: P1F3-5-4

Resource Type: seed

Availability: available

Donors:
  • Jose Alonso
  • Anna Stepanova
  • Jeonga Yun

Donation Date: 02/17/2012

Date Released: 03/12/2012

Description:

This whole-gene translation fusion was generated by recombineering (Zhou et al. (2011) Plant J. 66:712-723). The Venus yellow fluorescent protein DNA sequence (obtained from Dr. Oliver Hobert at Columbia University Medical Center, New York. (ref. PLoS ONE 4(3): e4625. doi:10.1371/journal.pone.0004625) was inserted just after the following sequence: CGCTACAATCCAAGACAGGTCTAGGAGGAGCCGAAGCAAGTCAACGAAAA (internal fusion in the gene At1g70940/PIN3) in the JAtY clone JAtY67J07. Transgenic plants are homozygous, but can be selected in BASTA.

Growth Requirement: none

Marker:

Background: Col (Columbia)

ABRC Comment:

Format Shipped: 100 seeds per vial

Base / Commercial Price: $15 / $120

Germplasm

2

Arabidopsis thaliana 3702

Additional Information

DOI PubMed
10.1111/j.1365-313X.2011.04524.x 21294796
Transgene Description Promoter Reporter Marker
Alonso-P1F3 PIN3 whole-gene translation fusion, Venus yellow fluorescent protein DNA sequence inserted just after the following sequence CGCTACAATCCAAGACAGGTCTAGGAGGAGCCGAAGCAAGTCAACGAAAA in the clone JAtY67J07 Venus BASTA

Quality Control Comments

There is no quality control data for this stock.