NASC stock number: N67173
donor stock number: P1G5-6
Resource Type: seed
Availability: available
Donors:- Jose Alonso
- Anna Stepanova
- Jeonga Yun
Donation Date: 02/17/2012
Date Released: 03/12/2012
Description:
This whole-gene translation fusion was generated by recombineering (Zhou et al. (2011) Plant J. 66:712-723). The Venus yellow fluorescent protein DNA sequence (obtained from Dr. Oliver Hobert at Columbia University Medical Center, New York. (ref. PLoS ONE 4(3): e4625. doi:10.1371/journal.pone.0004625) was inserted just after the following sequence: (i.e. just after the start codon):GTCTTCTTATACTCCAGAGTGAAGGGTATTAAGCCAAAGCCAAAGACTGCT of the gene At2g38120/AUX1 in the JAtY clone JAtY74H17. Transgenic plants are hemizygous and can be selected in BASTA.
Growth Requirement: basta resistant
Marker:
Background: Col (Columbia)
ABRC Comment:
Format Shipped: 100 seeds per vial
Base / Commercial Price: $15 / $120
Germplasm
Ploidy: 2
Taxon: Arabidopsis thaliana 3702
Publications
| DOI | PubMed |
|---|---|
| 10.1111/j.1365-313X.2011.04524.x | 21294796 |
Transgenes
| Transgene | Description | Promoter | Reporter | Marker |
|---|---|---|---|---|
| Alonso-P1G5 | AUX1 whole-gene translation fusion, Venus yellow fluorescent protein DNA sequence inserted just after the following sequence (i.e. just after the start codon):GTCTTCTTATACTCCAGAGTGAAGGGTATTAAGCCAAAGCCAAAGACTGCT in the clone JAtY74H17 | Venus | BASTA |
Quality Control Comments
There is no quality control data for this stock.