Name / Stock Number: CS67180

NASC stock number: N67180

donor stock number: P1D9-4-9

Resource Type: seed

Availability: available

Donors:
  • Jose Alonso
  • Anna Stepanova
  • Jeonga Yun

Donation Date: 02/17/2012

Date Released: 03/12/2012

Description:

This whole-gene translation fusion was generated by recombineering (Zhou et al. (2011) Plant J. 66:712-723). The Venus yellow fluorescent protein DNA sequence (obtained from Dr. Oliver Hobert at Columbia University Medical Center, New York. (ref. PLoS ONE 4(3): e4625. doi:10.1371/journal.pone.0004625) was inserted just after the following sequence: (i.e. just before the stop codon):GTCTTCTTATACTCCAGAGTGAAGGGTATTAAGCCAAAGCCAAAGACTGCT of the gene At5g33320) in the JAtY clone JAtY64L21. Transgenic plants are homozygous, but can be selected in BASTA.

Growth Requirement: none

Marker:

Background: Col (Columbia)

ABRC Comment:

Format Shipped: 100 seeds per vial

Base / Commercial Price: $15 / $120

Germplasm

2

Arabidopsis thaliana 3702

Additional Information

DOI PubMed
10.1111/j.1365-313X.2011.04524.x 21294796
Transgene Description Promoter Reporter Marker
Alonso-P1D9 At5g33320 whole-gene translation fusion, Venus yellow fluorescent protein DNA sequence inserted just after the following sequence (i.e. just before the stop codon of the gene):GTCTTCTTATACTCCAGAGTGAAGGGTATTAAGCCAAAGCCAAAGACTGCT in the clone JAtY64L21 Venus BASTA

Quality Control Comments

There is no quality control data for this stock.