NASC stock number: N67184
donor stock number: P1G10-1-1
Resource Type: seed
Availability: available
Donors:- Jose Alonso
- Anna Stepanova
- Jeonga Yun
Donation Date: 02/17/2012
Date Released: 03/12/2012
Description:
This whole-gene translation fusion was generated by recombineering (Zhou et al. (2011) Plant J. 66:712-723). The Venus yellow fluorescent protein DNA sequence (obtained from Dr. Oliver Hobert at Columbia University Medical Center, New York. (ref. PLoS ONE 4(3): e4625. doi:10.1371/journal.pone.0004625) was inserted just after the following sequence:TGGCAACGGACGGTGGGAACAACATAAGCAACAAAACGACGCAGGCTAAG (internal fusion in the gene At1g73590/PIN1) in the JAtY clone JAtY72A17. Transgenic plants are hemizygous and can be selected in BASTA.
Growth Requirement: basta resistant
Marker:
Background: Col (Columbia)
ABRC Comment:
Format Shipped: 100 seeds per vial
Base / Commercial Price: $15 / $120
Germplasm
2
Arabidopsis thaliana 3702
Additional Information
| DOI | PubMed |
|---|---|
| 10.1111/j.1365-313X.2011.04524.x | 21294796 |
| Transgene | Description | Promoter | Reporter | Marker |
|---|---|---|---|---|
| Alonso-P1G10 | PIN1 whole-gene translation fusion, Venus yellow fluorescent protein DNA sequence inserted just after the following sequence: TGGCAACGGACGGTGGGAACAACATAAGCAACAAAACGACGCAGGCTAAG in the clone JAtY72A17 | Venus | BASTA |
Quality Control Comments
There is no quality control data for this stock.