Name / Stock Number: CS67187

View Order History

NASC stock number: N67187

donor stock number: P1C12-7-1

Resource Type: seed

Availability: available

Donors:
  • Jose Alonso
  • Anna Stepanova
  • Jeonga Yun

Donation Date: 02/17/2012

Date Released: 03/12/2012

Description:

This whole-gene translation fusion was generated by recombineering (Zhou et al. (2011) Plant J. 66:712-723). The Venus yellow fluorescent protein DNA sequence (obtained from Dr. Oliver Hobert at Columbia University Medical Center, New York. (ref. PLoS ONE 4(3): e4625. doi:10.1371/journal.pone.0004625) was inserted just after the following sequence:CAGAGCTAAACCCTAAAGAAGCTATAGAAACGGGTGAAACTGTACCGGTA (internal fusion in the gene At1g23080/PIN7) in the JAtY clone JAtY61N20. Transgenic plants are homozygous, but can be selected in BASTA.

Growth Requirement: none

Marker:

Background: Col (Columbia)

ABRC Comment:

Format Shipped: 100 seeds per vial

Base / Commercial Price: $15 / $120

Germplasm

2

Arabidopsis thaliana 3702

Additional Information

DOI PubMed
10.1111/j.1365-313X.2011.04524.x 21294796
Transgene Description Promoter Reporter Marker
Alonso-P1C12 PIN7 whole-gene translation fusion, Venus yellow fluorescent protein DNA sequence inserted just after the following sequence: CAGAGCTAAACCCTAAAGAAGCTATAGAAACGGGTGAAACTGTACCGGTA in the clone JAtY61N20 Venus BASTA

Quality Control Comments

Add your quality control comment here

There is no quality control data for this stock.