Name / Stock Number: CS67192

NASC stock number: N67192

donor stock number: P2H1-4-18

Resource Type: seed

Availability: available

Donors:
  • Jose Alonso
  • Anna Stepanova
  • Jeonga Yun

Donation Date: 02/17/2012

Date Released: 03/12/2012

Description:

This whole-gene translation fusion was generated by recombineering (Zhou et al. (2011) Plant J. 66:712-723). The Ypet yellow fluorescent protein DNA just after the following sequence: (i.e. just before the stop codon): GACTTAAGGAGCTTGAGAAACTAACCAAGTCTCTTAAATCTGCTCTTCTT of the gene At3g54640 in the JAtY clone JAtY51M18. Transgenic plants are homozygous, but can be selected in BASTA.

Growth Requirement: none

Marker:

Background: Col (Columbia)

ABRC Comment:

Format Shipped: 100 seeds per vial

Base / Commercial Price: $15 / $120

Germplasm

2

Arabidopsis thaliana 3702

Additional Information

DOI PubMed
10.1111/j.1365-313X.2011.04524.x 21294796
Transgene Description Promoter Reporter Marker
Alonso-P2H1 At3g54640 whole-gene translation fusion, Ypet yellow fluorescent protein DNA sequence inserted just after the following sequence (i.e. just before the stop codon of the gene): GACTTAAGGAGCTTGAGAAACTAACCAAGTCTCTTAAATCTGCTCTTCTT in the clone JAtY51M18 YFP BASTA

Quality Control Comments

There is no quality control data for this stock.