NASC stock number: N67209
donor stock number: P2B6-3-13
Resource Type: seed
Availability: available
Donors:- Jose Alonso
- Anna Stepanova
- Jeonga Yun
Donation Date: 02/17/2012
Date Released: 03/12/2012
Description:
This whole-gene translation fusion was generated by recombineering (Zhou et al. (2011) Plant J. 66:712-723). The Ypet yellow fluorescent protein DNA just after the following sequence: (i.e. just before the stop codon): TTCAGAGCTATTTAGAGAAAGAAGATGGTATGGCTAGACCAGATGGACTC of the gene At4g39540 in the JAtY clone JAtY62K05. Transgenic plants are homozygous, but can be selected in BASTA.
Growth Requirement: none
Marker:
Background: Col (Columbia)
ABRC Comment:
Format Shipped: 100 seeds per vial
Base / Commercial Price: $15 / $120
Germplasm
2
Arabidopsis thaliana 3702
Additional Information
DOI | PubMed |
---|---|
10.1111/j.1365-313X.2011.04524.x | 21294796 |
Transgene | Description | Promoter | Reporter | Marker |
---|---|---|---|---|
Alonso-P2B6 | At4g39540 whole-gene translation fusion, Ypet yellow fluorescent protein DNA sequence inserted just after the following sequence (i.e. just before the stop codon of the gene): TTCAGAGCTATTTAGAGAAAGAAGATGGTATGGCTAGACCAGATGGACTC in the clone JAtY62K05 | YFP | BASTA |
Quality Control Comments
There is no quality control data for this stock.