Name / Stock Number: CS67212

View Order History

NASC stock number: N67212

donor stock number: P2C6-5-6

Resource Type: seed

Availability: available

Donors:
  • Jose Alonso
  • Anna Stepanova
  • Jeonga Yun

Donation Date: 02/17/2012

Date Released: 03/12/2012

Description:

This whole-gene translation fusion was generated by recombineering (Zhou et al. (2011) Plant J. 66:712-723). The Ypet yellow fluorescent protein DNA just after the following sequence: (i.e. just before the stop codon): AGACGCTTGATTCTTGGATAAACATCTCAAACTTAGCTCAGAAATCTCAG of the gene At5g17990 in the JAtY clone JAtY63L17. Transgenic plants are homozygous, but can be selected in BASTA.

Growth Requirement: none

Marker:

Background: Col (Columbia)

ABRC Comment:

Format Shipped: 100 seeds per vial

Base / Commercial Price: $15 / $120

Germplasm

2

Arabidopsis thaliana 3702

Additional Information

DOI PubMed
10.1111/j.1365-313X.2011.04524.x 21294796
Transgene Description Promoter Reporter Marker
Alonso-P2C6 At5g17990 whole-gene translation fusion, Ypet yellow fluorescent protein DNA sequenceinserted just after the following sequence (i.e. just before the stop codon of the gene): AGACGCTTGATTCTTGGATAAACATCTCAAACTTAGCTCAGAAATCTCAG in the clone JAtY63L17 YFP BASTA

Quality Control Comments

Add your quality control comment here

There is no quality control data for this stock.