Name / Stock Number: CS67224

NASC stock number: N67224

donor stock number: P2H8-4-9

Resource Type: seed

Availability: available

Donors:
  • Jose Alonso
  • Anna Stepanova
  • Jeonga Yun

Donation Date: 02/17/2012

Date Released: 03/12/2012

Description:

This whole-gene translation fusion was generated by recombineering (Zhou et al. (2011) Plant J. 66:712-723). The Ypet yellow fluorescent protein DNA just after the following sequence: (i.e. just before the stop codon): ACCCTGAGAAAGGAATAGCTGGACTTTTTGGCAGGAACATTTCTCATACT of the gene At2g04400 in the JAtY clone JAtY67N14. Transgenic plants are homozygous, but can be selected in BASTA.

Growth Requirement: none

Marker:

Background: Col (Columbia)

ABRC Comment:

Format Shipped: 100 seeds per vial

Base / Commercial Price: $15 / $120

Germplasm

2

Arabidopsis thaliana 3702

Additional Information

Transgene Description Promoter Reporter Marker
Alonso-P2H8 At2g04400 whole-gene translation fusion, Ypet yellow fluorescent protein DNA sequence inserted just after the following sequence (i.e. just before the stop codon of the gene): ACCCTGAGAAAGGAATAGCTGGACTTTTTGGCAGGAACATTTCTCATACT in the clone JAtY67N14 YFP BASTA

Quality Control Comments

There is no quality control data for this stock.