ABRC
NASC stock number: N68113
donor stock number: dcl1-15
Resource Type: seed
Availability: available
Donors:- Pablo Jenik
Donation Date: 09/04/2013
Date Released: 10/03/2013
Description:
Ws/Ler line mutagenized with EMS. Backcrossed 4 times to Ler (plants are er/er), then selfed twice. Several heterozygous plants were pooled for seeds.
Growth Requirement: none
Marker:
Background:
ABRC Comment: Heterozygous dcl1-15 mutants can be identified by PCR genotyping using the following primers: gty-TaqI: GAGACTGCAAAGCACCAAAAGTTCTCG; dcl1 R9: GTCACCATGGGCTGAAGCAA. The PCR product is 228 bp. After digestion with TaqaI restriction enzyme, mutant band will be cut (200 bp + 28 bp), wildtype band will be uncut (228 bp).
Format Shipped: 100 seeds per vial
Base / Commercial Price: $15 / $120
Germplasm
Ploidy: 2
Phenotype: Homozygous mutants are embryo lethal. Early embryos of homozygous mutants accumulate more chlorophyll, mature earlier than the wild-type, and have abnormal patterns of cell division. A second segregating T-DNA insertion slightly increases carpel number.
Taxon: Arabidopsis thaliana 3702
Publications
| DOI | PubMed |
|---|---|
| 10.1104/pp.110.171355 | 21330492 |
Quality Control Comments
There is no quality control data for this stock.