Name / Stock Number: CS68740

donor stock number: rpm1 rps2

NASC stock number: N68740

other name: rpm1-3 rps2-101c

Resource Type: seed

Availability: available

Donors:
  • Jeff Dangl

Donation Date: 06/25/2014

Date Released: 06/02/2016

Description:

Double mutant generated by crossing rpm1-3 (CS68739) and rps2-101c. Homozygous rpm1-3 (formerly called rps3-3) mutant plants were selected with the dCAPS marker (5 -AATTAACCCTCACTAAAGAGAACATGGAAGAGACTTGT-3 ; 3 -ACTGCTGTGAAGTGAGCTGTTT-5 ; digested with AvrII); Homozygous rps2-101c mutant plants were selected with the dCAPS marker (5 -TGTTTATGGACCTGGTGGGGT -3 ; 3 - ACAGCTCCCACGCGTGTTTCT -5 ; digested with DdeI)

Growth Requirement: none

Marker:

Background: Col (Columbia)

ABRC Comment:

Format Shipped: 100 seeds per vial

Base / Commercial Price: $15 / $120

Germplasm

2

Susceptible to bacterial pathogen Pseudomonas syringae pv. tomato DC3000 (Pto DC3000) carrying virulence effector gene avrRpm1, avrB, or avrRpt2.

Arabidopsis thaliana 3702

Additional Information

DOI PubMed
10.1016/S0092-8674(02)00661-X 11955429

Quality Control Comments

There is no quality control data for this stock.