donor stock number: rpm1 rps2
NASC stock number: N68740
other name: rpm1-3 rps2-101c
Resource Type: seed
Availability: available
Donors:- Jeff Dangl
Donation Date: 06/25/2014
Date Released: 06/02/2016
Description:
Double mutant generated by crossing rpm1-3 (CS68739) and rps2-101c. Homozygous rpm1-3 (formerly called rps3-3) mutant plants were selected with the dCAPS marker (5 -AATTAACCCTCACTAAAGAGAACATGGAAGAGACTTGT-3 ; 3 -ACTGCTGTGAAGTGAGCTGTTT-5 ; digested with AvrII); Homozygous rps2-101c mutant plants were selected with the dCAPS marker (5 -TGTTTATGGACCTGGTGGGGT -3 ; 3 - ACAGCTCCCACGCGTGTTTCT -5 ; digested with DdeI)
Growth Requirement: none
Marker:
Background: Col (Columbia)
ABRC Comment:
Format Shipped: 100 seeds per vial
Base / Commercial Price: $15 / $120
Germplasm
2
Susceptible to bacterial pathogen Pseudomonas syringae pv. tomato DC3000 (Pto DC3000) carrying virulence effector gene avrRpm1, avrB, or avrRpt2.
Arabidopsis thaliana 3702
Additional Information
| DOI | PubMed |
|---|---|
| 10.1016/S0092-8674(02)00661-X | 11955429 |
Quality Control Comments
There is no quality control data for this stock.