Name / Stock Number: CS68750

NASC stock number: N68750

other name: sgt1aKO

donor stock number: sgt1a

Resource Type: seed

Availability: available

Donors:
  • Jeff Dangl

Donation Date: 06/25/2014

Date Released: 09/03/2014

Description:

sgt1aKO mutnat; Identified by PCR genotyping from SALK line (SALK_122139). Homozygous sgt1aKO mutant plants were selected with three PCR primers: Primer LP: CTTGAAAAGGGTGCCTCTATCACGC; Primer RP: CATCAGATGACACTGAAGAAGGAAAAGG; SALKLB: CCACCATCAAACAGGATTTTCGCCTGCTGGGGC. LP and RP are flanking primers, amplify in absence of insertion. RP and SALKLB are insertion specific primers, amplify in presence of insertion.

Growth Requirement: none

Marker:

Background: Col (Columbia)

ABRC Comment:

Format Shipped: 100 seeds per vial

Base / Commercial Price: $15 / $120

Germplasm

2

Arabidopsis thaliana 3702

Additional Information

DOI PubMed
10.1126/science.1109977 15976272
Transgene Description Promoter Reporter Marker
pROK2 T-DNA kanamycin

Quality Control Comments

There is no quality control data for this stock.