NASC stock number: N68750
other name: sgt1aKO
donor stock number: sgt1a
Resource Type: seed
Availability: available
Donors:- Jeff Dangl
Donation Date: 06/25/2014
Date Released: 09/03/2014
Description:
sgt1aKO mutnat; Identified by PCR genotyping from SALK line (SALK_122139). Homozygous sgt1aKO mutant plants were selected with three PCR primers: Primer LP: CTTGAAAAGGGTGCCTCTATCACGC; Primer RP: CATCAGATGACACTGAAGAAGGAAAAGG; SALKLB: CCACCATCAAACAGGATTTTCGCCTGCTGGGGC. LP and RP are flanking primers, amplify in absence of insertion. RP and SALKLB are insertion specific primers, amplify in presence of insertion.
Growth Requirement: none
Marker:
Background: Col (Columbia)
ABRC Comment:
Format Shipped: 100 seeds per vial
Base / Commercial Price: $15 / $120
Germplasm
2
Arabidopsis thaliana 3702
Additional Information
| DOI | PubMed |
|---|---|
| 10.1126/science.1109977 | 15976272 |
| Transgene | Description | Promoter | Reporter | Marker |
|---|---|---|---|---|
| pROK2 | T-DNA | kanamycin |
Quality Control Comments
There is no quality control data for this stock.