NASC stock number: N68765
other name: hsp90.2-5
donor stock number: hsp90.2KO
Resource Type: seed
Availability: not distributed, currently distributed as CS68729
Donors:- Jeff Dangl
Donation Date: 06/25/2014
Date Released: 09/03/2014
Description:
hsp90.2-5KO mutant; Identified by PCR genotyping from SALK line (SALK_058553). Homozygous hsp90.2KO mutant plants were selected with three PCR primers: Primer LP: CAAGGAAGGTCTGAAACTGGATGAG; Primer RP: CTACTAATACCCTGACAAAATTC; SALKLB: CCACCATCAAACAGGATTTTCGCCTGCTGGGGC. LP and RP are flanking primers, amplify in absence of insertion. RP and SALKLB are insertion specific primers, amplify in presence of insertion.
Growth Requirement: none
Marker:
Background: Col (Columbia)
ABRC Comment:
Format Shipped: 100 seeds per vial
Base / Commercial Price: $15 / $120
Germplasm
2
Increased occurrence of developmental defects including narrowly-shaped deformed true leaves and delayed development. Pleiotropic developmental changes are very modest.
Arabidopsis thaliana 3702
Additional Information
| DOI | PubMed |
|---|---|
| 10.1093/emboj/cdg547 | 14592967 |
| Transgene | Description | Promoter | Reporter | Marker |
|---|---|---|---|---|
| pROK2 | T-DNA | kanamycin |
Quality Control Comments
There is no quality control data for this stock.