ABRC
donor stock number: coi1-1/COI1 rpm1 RPM1-myc
NASC stock number: N68796
other name: coi1-1/COI1 rpm1-1 RPM1-myc
Resource Type: seed
Availability: available
Donors:- Jeff Dangl
Donation Date: 06/25/2014
Date Released: 06/02/2016
Description:
coi1-1 mutant containing pRPM1::RPM1::myc transgene; Plants containing pRPM1::RPM1::myc constructor selected with primers: 5 - caatgcatacatgggacctaggttg -3 and 3 - cgtaattcaacagaaattatatgataatcatcgcaa -5 ; coi1-1 is segregating for the mutation. coi1-1 mutant plants were selected with the dCAP marker 5 -GGC GGT GTA TGT CTC AGA TAT AAC TAA CGA ATC TCT TGA AAG C-3 and 3 -CCT TCA TCT GAT TCA CCT ACG TAA CCC AGC AGA AT-5 digested with EcoRI). Homozygous rpm1-1 mutant plants were selected with the dCAP marker (5 -cgaagacattctcgacgagtttggata-3 ; 3 -cactttgcatcgccatcatcaatagg-5 ; digested with EcoRV). Homozygous for the transgene.
Growth Requirement: none
Marker:
Background: Col (Columbia)
ABRC Comment:
Format Shipped: 100 seeds per vial
Base / Commercial Price: $15 / $120
Germplasm
Ploidy: 2
Phenotype: coi1 homozygotes are male sterile.
Taxon: Arabidopsis thaliana 3702
Publications
| DOI | PubMed |
|---|---|
| 10.1371/journal.pgen.1003018 | 23093946 |
Transgenes
| Transgene | Description | Promoter | Reporter | Marker |
|---|---|---|---|---|
| pRPM1::RPM1::myc |
Quality Control Comments
There is no quality control data for this stock.