Arabidopsis Biological Resource Center

Description:

rpm1-3 coi1-21 rar1-21 triple mutant containing pRPM1::RPM1::myc transgene and 35S::SGT1b::HA transgene; Plants containing pRPM1::RPM1::myc constructor selected with primers: 5 - caatgcatacatgggacctaggttg -3 and 3 - cgtaattcaacagaaattatatgataatcatcgcaa -5 . rpm1-3 (CS68739, formerly called rps3-3) mutant plants containing pRPM1::RPM1::myc constructor were selected with a 2-step dCAPs marker: Step 1: genomic RPM1 fragment is amplified with primers: AAATGAAACGCACGCCAAATTTTGGCGCAGCTACGATAACCGTGGACGCG and CAGTGGTGAATCCTCTTTCATTGGGAGCTTGAAGACGGTTAACGAATTC; Step 2: the product of step 1 is used as PCR template with the primers: AAATGAAACGCACGCCAAATTTTGGCGCAGCTACGATAACCGTGGACGCG and GGTGTGAACCGAAAGCTTGGCTTTGCTCAAATTCAGCAAG, PCR product is digested with MluI. Homozygous rar1-21 mutant plants were selected with the dCAP marker (5 -TCACGACGGAATGAAAGAGTGGAGCTGCTACTAG-3 ; 3 -TTTTGGAACCGATTTGGCCAGAACTGGTTTCTCAG-5 ; digested with SpeI). Homozygous coi1-21 mutant plants were selected with the dCAP marker (5 - GAC AAC ACT TGT TGT TTT TCT TCA GAC AAG GAA TGT AAC CG-3 and 3 -GGT CGA GTA AGA CAA GGC GGA AGT CAC AGA GGT T-5 , digested with HpaII); Plants expressing 35S::SGT1b::HA are selected with HA blot. Homozygous for both transgenes.

Growth Requirement: none

Marker:

Background: Col (Columbia)

ABRC Comment:

Format Shipped: 100 seeds per vial

Base / Commercial Price: $15 / $120