donor stock number: tir1-9
NASC stock number: N69690
other name: MP2087
Resource Type: seed
Availability: available
Donors:- Mike Prigge
- Mark Estelle
Donation Date: 11/28/2016
Date Released: 02/01/2017
Description:
Isolated from the K. Feldmann T-DNA collection. The T-DNA insertion replaces the region including the last 71 bp of the first intron to the first 4 bp of exon 2. Both 5' and 3' junctions were amplified with LB primer (catagatgcactcgaaatcagc) and sequenced.
Growth Requirement: none
Marker:
Background: Ws (Wassilewskija)
ABRC Comment:
Format Shipped: 100 seeds per vial
Base / Commercial Price: $15 / $120
Germplasm
2
Resistant to IAA.
Arabidopsis thaliana 3702
Additional Information
| DOI | PubMed |
|---|---|
| 10.1101/gad.12.2.198 | 9436980 |
| Transgene | Description | Promoter | Reporter | Marker |
|---|---|---|---|---|
| 3850:1003 | T-DNA | kanamycin |
Quality Control Comments
There is no quality control data for this stock.