Name / Stock Number: CS69690

donor stock number: tir1-9

NASC stock number: N69690

other name: MP2087

Resource Type: seed

Availability: available

Donors:
  • Mike Prigge
  • Mark Estelle

Donation Date: 11/28/2016

Date Released: 02/01/2017

Description:

Isolated from the K. Feldmann T-DNA collection. The T-DNA insertion replaces the region including the last 71 bp of the first intron to the first 4 bp of exon 2. Both 5' and 3' junctions were amplified with LB primer (catagatgcactcgaaatcagc) and sequenced.

Growth Requirement: none

Marker:

Background: Ws (Wassilewskija)

ABRC Comment:

Format Shipped: 100 seeds per vial

Base / Commercial Price: $15 / $120

Germplasm

2

Resistant to IAA.

Arabidopsis thaliana 3702

Additional Information

DOI PubMed
10.1101/gad.12.2.198 9436980
Transgene Description Promoter Reporter Marker
3850:1003 T-DNA kanamycin

Quality Control Comments

There is no quality control data for this stock.