NASC stock number: N73884
donor stock number: cdca7a cdca7b
Resource Type: seed
Availability: not available
Donors:- Steve Jacobsen
Donation Date: 06/10/2025
Date Released: 06/27/2025
Description:
CRISPR mutant of CDCA7A (AT2G23530) and CDCA7B (AT4G37110); an insertion at guide TTGGGAATACAGAAAGAAGC introduces an early stop codon in CDCA7A; an insertion at guide AAGGCCAGAGATTTACACTG introduces an early stop codon in CDCA7B
Growth Requirement: none
Marker:
Background: Col (Columbia)
ABRC Comment:
Format Shipped: 100 seeds per vial
Base / Commercial Price: $15 / $120
Germplasm
Ploidy: 2
early flowering
Taxon: Arabidopsis thaliana 3702
Quality Control Comments
There is no quality control data for this stock.