Name / Stock Number: CS73884

NASC stock number: N73884

donor stock number: cdca7a cdca7b

Resource Type: seed

Availability: available

Donors:
  • Steve Jacobsen

Donation Date: 06/10/2025

Date Released: 06/27/2025

Description:

CRISPR mutant of CDCA7A (AT2G23530) and CDCA7B (AT4G37110); an insertion at guide TTGGGAATACAGAAAGAAGC introduces an early stop codon in CDCA7A; an insertion at guide AAGGCCAGAGATTTACACTG introduces an early stop codon in CDCA7B

Growth Requirement: none

Marker:

Background: Col (Columbia)

ABRC Comment:

Format Shipped: 100 seeds per vial

Base / Commercial Price: $15 / $120

Germplasm

Ploidy: 2

Phenotype: early flowering

Taxon: Arabidopsis thaliana 3702

Quality Control Comments

There is no quality control data for this stock.