NASC stock number: N9911
donor stock number: pMDC7-AtCKX3
Resource Type: seed
Availability: available
Donors:- Brian Jones
- Karin Ljung
Donation Date: 06/27/2011
Date Released: 02/22/2012
Description:
Transgenic line; the coding sequence of CYTOKININ OXIDASE 3 (At5G56970) was amplified with the primers CKX3-F1 (5'- CACCAATGGCGAGTTATAATCTTCGTTC -3') and CKX3-R1- (5'- CTACTAACTCGAGTTTATTTTTTGA -3'); the PCR product was cloned into the estradiol inducible binary vector pMDC7 via pTOPO TA GATEWAY (Invitrogen) according to the manufacturers instructions; Arabidopsis plants (ecotype Columbia Col-0) were transformed by A. tumifaciens-mediated floral dip transformation
Growth Requirement: Hygromycin resistant
Marker:
Background: Col (Columbia)
ABRC Comment:
Format Shipped: 100 seeds per vial
Base / Commercial Price: $15 / $120
Germplasm
2
Arabidopsis thaliana 3702
Additional Information
| Transgene | Description | Promoter | Reporter | Marker |
|---|---|---|---|---|
| pMDC7-AtCKX3 | estradiol inducible promoter, coding sequence of CYTOKININ OXIDASE 3 | hygromycin |
Quality Control Comments
There is no quality control data for this stock.