Name / Stock Number: CS9911

NASC stock number: N9911

donor stock number: pMDC7-AtCKX3

Resource Type: seed

Availability: available

Donors:
  • Brian Jones
  • Karin Ljung

Donation Date: 06/27/2011

Date Released: 02/22/2012

Description:

Transgenic line; the coding sequence of CYTOKININ OXIDASE 3 (At5G56970) was amplified with the primers CKX3-F1 (5'- CACCAATGGCGAGTTATAATCTTCGTTC -3') and CKX3-R1- (5'- CTACTAACTCGAGTTTATTTTTTGA -3'); the PCR product was cloned into the estradiol inducible binary vector pMDC7 via pTOPO TA GATEWAY (Invitrogen) according to the manufacturers instructions; Arabidopsis plants (ecotype Columbia Col-0) were transformed by A. tumifaciens-mediated floral dip transformation

Growth Requirement: Hygromycin resistant

Marker:

Background: Col (Columbia)

ABRC Comment:

Format Shipped: 100 seeds per vial

Base / Commercial Price: $15 / $120

Germplasm

2

Arabidopsis thaliana 3702

Additional Information

Transgene Description Promoter Reporter Marker
pMDC7-AtCKX3 estradiol inducible promoter, coding sequence of CYTOKININ OXIDASE 3 hygromycin

Quality Control Comments

There is no quality control data for this stock.