Name / Stock Number: pGEM-T Easy221 amiR-TPL151 / PGEM-T EASY221 AMIR-TPL151

Resource Type: plasmid

Availability: available

Donors:
  • Maria-Rosa Ponce
  • Jose Micol

Donation Date: 06/21/2013

Date Released: 02/25/2015

Description:

Entry gateway vector (pGEM T-Easy221) containing an artificial miRNA-producing transgene designed to silence a group of genes: At3g07340, At5g48560. Ampicillin resistant. amiRNA sequence: UAUGUACACCCAUGAAUCCUG; amiRNA* sequence: CAAGAUUCAUGGGAGUACAUU

Growth Requirement: grow in LB media at 37 C overnight

Marker: ampicillin

Background: Col (Columbia)

ABRC Comment: This material contains Gateway(TM) Technology owned by ThermoFisher Scientific (formerly known as Life Technologies/ Invitrogen Corporation). Distributed under Gateway Open Architecture Policy.

Format Shipped: bacterial stab

Base / Commercial Price: $15 / $120

Plasmid

Promoter:

Reporter:

Type: RNAi clone

E. coli DH5-alpha

Taxon: Arabidopsis thaliana 3702

Publications

DOI PubMed
10.1111/tpj.12609 25040904

Quality Control Comments

There is no quality control data for this stock.

Note

Gateway(TM)_Open_Architecture

When it was initially launched in 1999, there were several use restrictions around Gateway Technology that required additional licensing. These limitations included research use by industrial entities, distribution of research materials by academic investigators, and any commercial use. In 2003, we instituted the Gateway Open Architecture in response to the urgent need of the research communities for open access to Gateway Technology for scientific research. The majority of genome-wide initiatives are funded by government agencies which require all resources and information, including data, software, and biological materials to be openly accessible. We realized that our policies were too restrictive, and instead of enabling your research with advanced technology, we were impeding it with our interest in protecting intellectual property. Our vision, including strategic business pursuits such as corporate licensing, must align with our customers needs. We believe we share a common quest with you to support and facilitate cutting-edge life science research; thus we have introduced a new open architecture for Gateway Technology. Under this new licensing policy:

Academic and government researchers may create and freely distribute Gateway entry clones (containing attL1 and attL2 sites) and expression clones (containing attB1 and attB2 sites) for research use without licensing fees or royalties.

Any organization may now freely distribute Gateway entry clones created by Academic or Government researchers, for research use, without paying licensing fees or royalties, and may distribute Gateway expression clones created by Academic or Government researchers, for research use, for a nominal fee of up to US $10 per clone.

The rights to perform the Gateway recombinational cloning reaction, for research purposes, with these distributed clones is conveyed by the purchase of InvitrogenTM Gateway ClonaseTM enzyme.

We will not assert a claim against the buyer of infringement based upon the manufacture, use or sale of a therapeutic, clinical diagnostic, vaccine or prophylactic product developed in research by the buyer provided that no method claim in the corresponding patents were used in the manufacture of such product.

We believe that this policy of open access to Gateway clones for scientific research purposes is the best way for us to support your efforts in the advancement of global life sciences. We are committed to ensuring that new information and resources will be accessible to the broader community by first, eliminating unwarranted licensing restrictions and by second, providing the resources necessary as a key distributor and partner.